Quick Order

Text Size:AAA

Human CANT1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CANT1 cDNA Clone Product Information
NCBI RefSeq:BC017655
RefSeq ORF Size:1206bp
cDNA Description:Full length Clone DNA of Homo sapiens calcium activated nucleotidase 1 with C terminal HA tag.
Gene Synonym:DBQD, SCAN1, SHAPY, SCAN-1, CANT1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CANT1(calcium activated nucleotidase 1) belongs to the apyrase family. Apyrase is a calcium-activated plasma membrane-bound enzyme (magnesium can also activate it) (EC 3.6.1.5) that catalyses the hydrolysis of ATP to yield AMP and inorganic phosphate. Two isoenzymes are found in commercial preparations from S. tuberosum. One with a higher ratio of substrate selectivity for ATP: ADP and another with no selectivity. It can also act on ADP and other nucleoside triphosphates and diphosphates with the general reaction being NTP -> NDP + Pi -> NMP + 2Pi. The salivary apyrases of blood-feeding arthropods are nucleotide hydrolysing enzymes are implicated in the inhibition of host platelet aggregation through the hydrolysis of extracellular adenosine diphosphate. CANT1 functions as a calcium-dependent nucleotidase with a preference for UDP. Defects in CANT1 are the cause of desbuquois dysplasia.

References
  • Failer BU, et al. (2002) Cloning, expression, and functional characterization of a Ca(2+)-dependent endoplasmic reticulum nucleoside diphosphatase. J Biol Chem. 277(40):36978-86.
  • Smith TM, et al. (2002) Cloning, expression, and characterization of a soluble calcium-activated nucleotidase, a human enzyme belonging to a new family of extracellular nucleotidases. Arch Biochem Biophys. 406(1):105-15.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Size / Price
    Catalog: HG13266-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"