After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human PIANP / C12ORF53 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PIANP cDNA Clone Product Information
Gene_bank_ref_id:BC035736
RefSeq ORF Size:849bp
cDNA Description:Full length Clone DNA of Homo sapiens PILR alpha associated neural protein with C terminal HA tag.
Gene Synonym:PANP, C12orf53
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

C12orf53 is mainly expressed in adult brain and cerebellum. It also can be detected in fetal brain and virtually no expression in spleen, heart, kidney, liver and dorsal ganglion relative to brain. C12orf53 acts as a ligand for PILRA in neural tissues, where it may be involved in immune regulation. Chromosome 12 encodes over 1,100 genes within 132 million bases. A number of skeletal deformities are linked to chromosome 12 including hypochondrogenesis, achondrogenesis and Kniest dysplasia. Noonan syndrome, which includes heart and facial developmental defects among the primary symptoms, is caused by a mutant form of PTPN11 gene product, SH-PTP2. Chromosome 12 is also home to a homeobox gene cluster which encodes crucial transcription factors for morphogenesis, and the natural killer complex gene cluster encoding C-type lectin proteins which mediate the NK cell response to MHC class I interaction.

References
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Tissue Antigens. Nat Genet. 36(1):40-5.
  • Kogure A, et al. (2011) PANP is a novel O-glycosylated PILR ligand expressed in neural tissues. Biochem Biophys Res Commun. 405(3):428-33.
  • Size / Price
    Catalog: HG13238-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"