Quick Order

Human HCST ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HCST cDNA Clone Product Information
Gene_bank_ref_id:BC035931
RefSeq ORF Size:282bp
cDNA Description:Full length Clone DNA of Homo sapiens hematopoietic cell signal transducer with N terminal His tag.
Gene Synonym:DAP10, KAP10, PIK3AP
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

HCST, also known as DAP10, belongs to the DAP10 family. It is a transmembrane signaling adaptor that contains a YxxM motif in its cytoplasmic domain. HCST may be part of the immune recognition receptor complex. This receptor plays a major role in triggering cytotoxicity against target cells expressing cell surface ligands such as MHC class I chain-related MICA and MICB, and UL16-binding proteins (ULBPs). It may activate phosphatidylinositol 3-kinase dependent signaling pathways through its intracytoplasmic YxxM motif.

References
  • Wu J. et al., 1999, Science. 285 (5428): 730-2.
  • Karimi M. et al., 2006, J Immunol. 175 (12): 7819-28.
  • André P. et al., 2004, Eur J Immunol. 34 (4): 961-71.
  • Size / Price
    Catalog: HG14063-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"