Quick Order

Text Size:AAA

Human PFKFB3 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PFKFB3 cDNA Clone Product Information
Gene_bank_ref_id:BC040482
RefSeq ORF Size:1563bp
cDNA Description:Full length Clone DNA of Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 with C terminal HA tag.
Gene Synonym:PFK2, IPFK2
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Fructose-2,6-biphosphatase 3, also known as 6-phosphofructo-2-kinase or PFK2 or PFKFB3, is a potent activator of phosphofructokinase, which is a rate-limiting enzyme of glycolysis. Highly phosphorylated PFKFB3 protein was found in human tumor cells, vascular endothelial cells, and smooth muscle cells. Fructose 2,6-bisphosphate (Fru-2,6-BP) is an allosteric activator of 6-phosphofructo-1-kinase (PFK-1), a rate-limiting enzyme and essential control point in glycolysis. The concentration of PFK2 depends on the activity of the bifunctional enzyme, 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase (PFK-2 / FBPase). PFK2 controls the glycolytic flux via the allosteric activator fructose 2,6-bisphosphate. Because of its proto-oncogenic character, the PFK-2/FBPase-2 of the PFKFB3 gene is assumed to play a critical role in tumorigenesis. The hypoxia-inducible form of 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase (PFKFB3) plays a crucial role in the progression of cancerous cells by enabling their glycolytic pathways even under severe hypoxic conditions.

References
  • Kessler R, et al. (2008) 6-Phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFKFB3) is up-regulated in high-grade astrocytomas. J Neurooncol. 86(3):257-64.
  • Yalcin A, et al. (2009) Nuclear targeting of 6-phosphofructo-2-kinase (PFKFB3) increases proliferation via cyclin-dependent kinases. J Biol Chem. 284(36):24223-32.
  • Atsumi T, et al. (2002) High expression of inducible 6-phosphofructo-2-kinase / fructose-2, 6-bisphosphatase (iPFK-2; PFKFB3) in human cancers. Cancer Res. 262(20): 5881-7.
  • Kim SG, et al. (2006) Crystal structure of the hypoxia-inducible form of 6-phosphofructo-2-kinase / fructose-2,6-bisphosphatase (PFKFB3): a possible new target for cancer therapy. J Biol Chem. 281(5): 2939-44.
  • Size / Price
    Catalog: HG13230-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"