Quick Order

Human TP63 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TP63cDNA Clone Product Information
cDNA Size:2043
cDNA Description:ORF Clone of Homo sapiens tumor protein p63 DNA.
Gene Synonym:AIS, KET, LMS, NBP, RHS, p40, p51, p63, EEC3, OFC8, p73H, p73L, SHFM4, TP53L, TP73L, p53CP, TP53CP, B(p51A), B(p51B), TP63
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Tumor protein p63 is a protein also known as transformation-related protein 63, TP63, and p63. Tumor protein p63 / p63 is a member of the p53 family of transcription factors whose members P53, p63, and p73 have similar features in their gene structures and functions. An animal model, p63-/- mice has been useful in difining the role p63 plays in the development and maintenance of stratified epithelial tissues. This p63 encoding protein p63 has a dramatic impact on replenishment of cutaneous epithelial stem cells and on ovarian germ cell survival. Although these two fundamental roles of p63 attest to its powerful place in development, its other functions, specifically the apparent capacity of p63, is to supervise the emergence of new cell populations in the breast, prostate, cervix, and upper reproductive tract. P63-/- mice have several development defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Mutations in this protein are associated with ectodermal dysplasia, and cleft lip / palate syndrome 3, ADULT syndrome (acro-dermato-ungual-lacrimal-tooth), limb-mammary syndrome, et al.

  • Crum CP, et al. (2010) p63 in epithelial survival, germ cell surveillance, and neoplasia. Annu Rev Pathol. 5: 349-71.
  • Tan M, et al. (2001) p53CP is p51/p63, the third member of the p53 gene family: partial purification and characterization. Carcinogenesis. 22 (2): 295-300.
  • Shiran MS, et al. (2007) p63 as a complementary basal cell specific marker to high molecular weight-cytokeratin in distinguishing prostatic carcinoma from benign prostatic lesions. Med J Malaysia. 62 (1): 36-9.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items