After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SERPINB3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINB3cDNA Clone Product Information
Gene_bank_ref_id:NM_006919.2
cDNA Size:1173
cDNA Description:ORF Clone of Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 3 DNA.
Gene Synonym:SCC, T4-A, SCCA1, SCCA-1, HsT1196, SCCA-PD, SERPINB3
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human SERPINB3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Related Products
Product nameProduct name
Background

SERPINB3, also known as SCCA-1, belongs to the serpin family. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases. SERPINB3 is expressed in some hepatocellular carcinoma (at protein level). Its expression is closely related to cellular differentiation in both normal and malignant squamous cells. It seems to also be secreted in plasma by cancerous cells but at a low level. SERPINB3 significantly attenuates apoptosis by contrasting cytochrome c release from the mitochondria and by antichemotactic effect for NK cells. It may act as a protease inhibitor to modulate the host immune response against tumor cells and may be involved in the malignant behavior of squamous cell carcinoma cells.

References
  • Schneider SS, et al. (1995) A serine proteinase inhibitor locus at 18q21.3 contains a tandem duplication of the human squamous cell carcinoma antigen gene. Proc Natl Acad Sci. 92(8):3147-51.
  • Suminami Y, et al.. (1992) Squamous cell carcinoma antigen is a new member of the serine protease inhibitors. Biochem Biophys Res Commun. 181(1):51-8.
  • Mino-Miyagawa N, et al. (1990) Tumor-antigen 4. Its immunohistochemical distribution and tissue and serum concentrations in squamous cell carcinoma of the lung and esophagus. Cancer. 66(7):1505-12.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"