Quick Order

Text Size:AAA

Mouse BMP-3b / GDF-10 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GDF10cDNA Clone Product Information
cDNA Size:1431
cDNA Description:ORF Clone of Mus musculus growth differentiation factor 10 DNA.
Gene Synonym:Gdf10
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.


BMP-3b / GDF-10 is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. Studies in mice suggest that the protein encoded by this gene plays a role in skeletal morphogenesis. In the bone morphogenetic cascade, cartilage differentiation, hypertrophy, and cell death are followed by bone formation. In this regard, all BMPs are cartilage morphogenetic proteins since cartilage is formed first. An overexpression or dysregulation of BMP pathways may lead to heterotopic bone formation or fibrodysplasia ossificans progressiva (FOP). BMPs have been implicated in FOP. The pioneering work of Sakou has implicated BMP-3b / GDF-10 in ossification of the posterior longitudinal ligament of the spine in Japanese patients. The BMP-specific antagonists such as noggin or chordin might be used therapeutically in clinical conditions with pathologically excessive bone formation. The osteoinductive capacity of BMPs has been demonstrated in preclinical models, and the efficacy of BMPs for the treatment of orthopaedic patients is now being evaluated in clinical trials. It was suggested that further progress in the clinical application of the BMP-3b / GDF-10 will depend upon the development of carriers with ideal release kinetics for the delivery of the BMPs.

  • Hino J, Takao M, Takeshita N, et al. (1996). "cDNA cloning and genomic structure of human bone morphogenetic protein-3B (BMP-3b).". Biochem. Biophys. Res. Commun. 223 (2): 304–10.
  • Kimura K, Toyooka S, Tsukuda K, et al. (2008). "The aberrant promoter methylation of BMP3b and BMP6 in malignant pleural mesotheliomas.". Oncol. Rep. 20 (5): 1265-8.
  • A. H. Reddi. (2001) Bone Morphogenetic Proteins: From Basic Science to Clinical Applications. Scientific Article. 83:1-6.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items