Quick Order

Text Size:AAA

Mouse S100A13 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100A13cDNA Clone Product Information
cDNA Size:297
cDNA Description:ORF Clone of Mus musculus S100 calcium binding protein A13 DNA.
Gene Synonym:S100a13
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Mouse S100A13 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Related Products
Product nameProduct name

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.  Protein S100-A13, also known as S100 calcium-binding protein A13, is a member of the S-100 family. It contains two EF-hand domains. S100A13 binds two calcium ions per subunit and one copper ion. Binding of one copper ion does not interfere with calcium binding. S100A13 is required for the copper-dependent stress-induced export of IL1A and FGF1. The calcium-free protein binds to lipid vesicles containing phosphatidylserine, but not to vesicles containing phosphatidylcholine. S100A13 plays a role in the export of proteins that lack a signal peptide and are secreted by an alternative pathway.

  • Mandinova A. et al., 2003, J Cell Sci. 116: 2687-96.
  • Arnesano F. et al., 2005, Angew Chem Int Ed. 44: 6341-4.
  • Viemann D. et al., 2005, Blood. 105: 2955-62.
  • Nakatani Y. et al., 2005, Mediators Inflamm. 2005: 280-92.
  • Bjoerk P. et al., 2009, PLoS Biol. 7: E97-E97.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items