After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse PLA2G2A ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PLA2G2A cDNA Clone Product Information
Gene_bank_ref_id:NM_001082531.1
RefSeq ORF Size:441bp
cDNA Description:Full length Clone DNA of Mus musculus phospholipase A2, group IIA (platelets, synovial fluid) with N terminal Flag tag.
Gene Synonym:EF, Mom1, Pla2, sPLA2, sPla2-IIA, Pla2g2a
Species:Mouse
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Phospholipase A2, membrane associated, also known as Phosphatidylcholine 2-acylhydrolase 2A, Group IIA phospholipase A2, Non-pancreatic secretory phospholipase A2 and PLA2G2A, is a peripheral membrane protein which belongs to the phospholipase A2 family. PLA2G2A is found in many cells and also extracellularly. The membrane-bound and secreted forms of PLA2G2A are identical. PLA2G2A has been proposed to play a role in anti-bacterial defense, inflammation and eicosanoid generation, in clearance of apoptotic cells, and in the Wnt signaling pathway. PLA2G2A is thought to participate in the regulation of the phospholipid metabolism in biomembranes including eicosanoid biosynthesis. PLA2G2A catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides. PLA2G2A might be a factor in human colorectal tumorigenesis.

References
  • Praml,C. et al., 1998, Oncogene. 17 (15):2009-12.
  • Fijneman,R.J. et al., 2008,Front Biosci 13 :4144-74.
  • Fijneman,R.J. et al., 2009, Cell Oncol  31 (5):345-56.
  • Size / Price
    Catalog: MG50203-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"