After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ECE-1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ECE1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001397.2
RefSeq ORF Size:2313bp
cDNA Description:Full length Clone DNA of Homo sapiens endothelin converting enzyme 1 with N terminal HA tag.
Gene Synonym:ECE, ECE1
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Endothelin-converting enzyme 1, also known as ECE-1, is a single-pass type I I membrane protein which belongs to the peptidase M13 family. ECE-1 converts big endothelin-1 to endothelin-1. ECE-1 is a membrane metalloprotease that generates endothelin from its direct precursor big endothelin. Four isoforms of ECE-1 are produced from a single gene through the use of alternate promoters. These isoforms share the same extracellular catalytic domain and contain unique cytosolic tails, which results in their specific subcellular targeting.All isoforms of ECE-1 are expressed in umbilical vein endothelial cells, polynuclear neutrophils, fibroblasts, atrium cardiomyocytes and ventricles. Isoforms A, B and C of ECE-1 are also expressed in placenta, lung, heart, adrenal gland and phaeochromocytoma; isoforms A and C of ECE-1 in liver, testis and small intestine; isoform B, C and D of ECE-1 in endothelial cells and umbilical vein smooth muscle cells; isoforms C and D in saphenous vein cells, and isoform C in kidney. Defects in ECE1 are a cause of Hirschsprung disease, cardiac defects and autonomic dysfunction. It is a form of Hirschsprung disease with skip-lesions defects, craniofacial abnormalities and other dysmorphic features, and autonomic dysfunction.

Size / Price
Catalog: HG10887-NY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"