After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human NGFR ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NGFR cDNA Clone Product Information
Gene_bank_ref_id:NM_002507.2
RefSeq ORF Size:1284bp
cDNA Description:Full length Clone DNA of Homo sapiens nerve growth factor receptor (TNFR superfamily, member 16) with C terminal HA tag.
Gene Synonym:CD271, p75NTR, TNFRSF16, p75(NTR), Gp80-LNGFR, NGFR
Species:Human
Vector:pCMV3-C-HA
Plasmid:pCMV3-NGFR-HA
Restriction Site:KpnI + XbaI (6kb + 1.33kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human NGFR Gene Plasmid Map
Human NGFR Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Background

Nerve growth factor receptors (NGFRs) belong to a large growth factor receptor family. NGFR includes two types of receptors: high-affinity nerve growth factor receptor and low-affinity nerve growth factor receptor. High-affinity nerve growth factor receptor is also referred as Trk familywhose members are bound by some neurotrophins with high affinity. Nerve growth factor binds with TrkA after being released from target cells, the NGF / TrkA complex is subsequently trafficked back to the cell body. The Low-affinity nerve growth factor receptor also named p75 which binds with all kinds of neurotrophins with low affinity. All the four kinds of neurotrophins, including Nerve growth factor, Brain derived neurotrophic factor, Neurotrophin-3, and Neurotrophin-4 bind to the p75. Studies have proved that NGFR acts as a molecular signal swith that determines cell death or survival by three steps. First, pro-nerve growth factor (prNGF) triggers cell apoptosis by its high affinity binding to p75NTR, while NGF induces neuronal survival with low-affinity binding. Second, p75NTR mediates cell death by combining with co-receptor sortilin, whereas it promotes neuronal survival through combination with proNGF. Third, release of the intracellular domain chopper or cleavage short p75 NTR can independently initiate neuronal apoptosis.

References
  • Chen LW, et al. (2008) The proNGF-p75NTR-sortilin signalling complex as new target for the therapeutic treatment of Parkinson's disease. CNS Neurol Disord Drug Targets. 7(6): 512-23.
  • Deponti D, et al. (2009) The low-affinity receptor for neurotrophins p75NTR plays a key role for satellite cell function in muscle repair acting via RhoA. Mol Biol Cell.20(16): 3620-7.
  • Ken-ichiro K, et al. (2004) Necdin-related MAGE proteins differentially interact with the E2F1 transcription factor and the p75 neurotrophin receptor. J Biol Chem. 279 (3): 1703-12.
  • Size / Price
    Catalog: HG13184-CY
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"