Quick Order

Mouse CXCL11 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CXCL11cDNA Clone Product Information
Gene_bank_ref_id:NM_019494.1
cDNA Size:303
cDNA Description:ORF Clone of Mus musculus chemokine (C-X-C motif) ligand 11 DNA.
Gene Synonym:IP9, H174, ITAC, b-R1, CXC11, I-TAC, SCYB9B, Scyb11, betaR1, Cxcl11
Species:Mouse
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Chemokine & Receptor Related Products
Product nameProduct name
Background

I-TAC, also known as CXCL11, is a small cytokine belonging to the CXC chemokine family. It is highly expressed in peripheral blood leukocytes, pancreas and liver, with moderate levels in thymus, spleen and lung and low expression levels were in small intestine, placenta and prostate. The I-TAC chemokine elicits its effects on its target cells by interacting with the cell surface chemokine receptor CXCR3, with a higher affinity than do the other ligands for this receptor, CXCL9 and CXCL10. I-TAC is chemotactic for activated T cells. The CXCL11 gene is located on human chromosome 4 along with many other members of the CXC chemokine family.

References
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Rani MR, et al. (2002) Requirement of phosphoinositide 3-kinase and Akt for interferon-beta-mediated induction of the beta-R1 (SCYB11) gene. J Biol Chem. 277(41): 38456-61.
  • Salmaggi A, et al. (2003) Expression and modulation of IFN-gamma-inducible chemokines (IP-10, Mig, and I-TAC) in human brain endothelium and astrocytes: possible relevance for the immune invasion of the central nervous system and the pathogenesis of multiple sclerosis. J Interferon Cytokine Res. 22(6):631-40.
  • Size / Price
    Catalog:MG50151-CF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"