Quick Order

Human CEBPG Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CEBPGcDNA Clone Product Information
cDNA Size:453
cDNA Description:ORF Clone of Homo sapiens CCAAT/enhancer binding protein (C/EBP), gamma DNA.
Gene Synonym:GPE1BP, IG/EBP-1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

CEBPG, also known as CEBP gamma, is a transcription factor which belongs to the CEBP family. Members of this family regulate viral and cellular CCAAT/enhancer element-mediated transcription. CEBP proteins contain the bZIP region, which is characterized by two motifs in the C-terminal half of the protein: a basic region involved in DNA binding and a leucine zipper motif involved in dimerization. CEBPG binds to the enhancer element PRE-I of the IL-4 gene. It Might change the DNA-binding specificity of other transcription factors and recruit them to unusual DNA sites.

  • Thomassin H. et al., 1992, Nucleic Acids Res. 20 (12): 3091-8.
  • Nishizawa M. et al., 1992, FEBS Lett. 299 (1): 36-8.
  • Williams SC. et al., 1991, Genes Dev. 5 (9): 1553-67.
  • Melchionna R. et al., 2012, J Invest Dermatol. 132 (7): 1908-17.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items