After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PRTFDC1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRTFDC1 cDNA Clone Product Information
Gene_bank_ref_id:BC008662
RefSeq ORF Size:678bp
cDNA Description:Full length Clone DNA of Homo sapiens phosphoribosyl transferase domain containing 1 with N terminal His tag.
Gene Synonym:HHGP, PRTFDC1
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

PRTFDC1 is a member of the purine/pyrimidine phosphoribosyltransferase family. It can bind GMP, IMP and alpha-D-5-phosphoribosyl 1-pyrophosphate (PRPP). The epigenetic silencing of PRTFDC1 by hypermethylation of the CpG island leads to a loss of PRTFDC1 function, which might be involved in squamous cell oral carcinogenesis. PRTFDC1 is a genetic modifier of HPRT-deficiency in the mouse and has important implications for unraveling the molecular etiology of lesch-Nyhan disease(LND). LND is a severe X-linked neurological disorder caused by a deficiency of hypoxanthine phosphoribosyltransferase. PRTFDC1 has a low, barely measurable phosphoribosyltransferase activity (in vitro).

References
  • Welin M. et al., 2010, FEBS J. 277 (23): 4920-30.
  • Keebaugh AC. et al., 2011, PLoS One. 6 (7): e22381.
  • Suzuki E. et al., 2007, Oncogene. 26 (57): 7921-32.
  • Size / Price
    Catalog: HG14023-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"