After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GNG13 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GNG13cDNA Clone Product Information
Gene_bank_ref_id:NM_016541.2
cDNA Size:204
cDNA Description:ORF Clone of Homo sapiens guanine nucleotide binding protein (G protein), gamma 13 DNA.
Gene Synonym:h2-35, G(gamma)13, GNG13
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

GNG13 is a subunit of heterotrimeric G proteins which consist of alpha, beta, and gamma subunits. Heterotrimeric G proteins are membrane bound GTPases that are linked to 7-TM receptors. They function as signal transducers for the 7-transmembrane-helix G protein-coupled receptors. They are involved as a modulator or transducer in various transmembrane signaling systems. Each G protein is composed of an alpha-, beta- and gamma-subunit and is bound to GDP in the 'off' state. Ligand-receptor binding results in detachment of the G protein, switching it to an 'on' state and permitting Galpha activation of second messenger signalling cascades. There are several types of Galpha proteins; in addition, some Gbetagamma subunits have active functions. Gbetagamma coupled to H1 receptors can activate PLA2 and Gbetagamma coupled to M1 receptors can activate KIR channels. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction. GNG13 is a gamma subunit that is expressed in taste, retinal, and neuronal tissues and plays a key role in taste transduction.

References
  • Huang L, et al. (2000) Ggamma13 colocalizes with gustducin in taste receptor cells and mediates IP3 responses to bitter denatonium. Nat Neurosci. 2 (12): 1055-62.
  • Blake B L, et al. (2001) G beta association and effector interaction selectivities of the divergent G gamma subunit G gamma(13). J Biol Chem. 276 (52): 49267-74.
  • Bonaldo MF, et al. (1997) Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res. 6 (9): 791-806.
  • Size / Price
    Catalog:HG13173-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"