After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human VSTM1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VSTM1 cDNA Clone Product Information
Gene_bank_ref_id:NM_198481.3
RefSeq ORF Size:711bp
cDNA Description:Full length Clone DNA of Homo sapiens V-set and transmembrane domain containing 1 with C terminal HA tag.
Gene Synonym:SIRL1, UNQ3033, MGC119160, MGC119161, VSTM1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

V-set and transmembrane domain containing 1 (VSTM1) is a protein containing the V-set domains. V-set domains are immunoglobulin-like domains resembling the antibody variable region. V-set domains are found in many kinds of protein families, including immunoglobulin light and heavy chains, several T-cells such as CD2, CD4, CD80, and CD86, myelin membrane adhesion molecules, junction adhesion molecules (JAM), tyrosine-protein kinase receptors, and the programmed cell death protein1.

References
  • Satow Y, et al. (1986) Phosphocholine binding immunoglobulin Fab McPC603. An X-ray diffraction study at 2.7 A. J Mol Biol. 190 (4): 593-604.
  • Rees DC, et al. (2009) ABC transporters: the power to change. Cell Biol. 10 (3): 218-227.
  • Size / Price
    Catalog: HG13171-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"