After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PTPRJ ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PTPRJ cDNA Clone Product Information
Gene_bank_ref_id:NM_002843.3
RefSeq ORF Size:4014bp
cDNA Description:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, receptor type, J with C terminal HA tag.
Gene Synonym:DEP1, SCC1, CD148, HPTPeta, R-PTP-ETA, PTPRJ
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

DEP1 / PTPRJ (Receptor-type tyrosine-protein phosphatase eta) is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes, including cell growth, differentiation, mitotic cycle, and oncogenic transformation. DEP1 / PTPRJ possesses an extracellular region containing five fibronectin type III repeats, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. DEP1 / PTPRJ is present in all hematopoietic lineages, and was shown to negatively regulate T cell receptor signaling possibly through interfering with the phosphorylation of Phospholipase C Gamma 1 and Linker for Activation of T Cells. This protein can also dephosphorylate the PDGF beta receptor, and may be involved in UV-induced signal transduction. In stable MCF-7 cell lines lines, induction of DEP-1 expression inhibited breast cancer cell growth by 5-10-fold. These data describe PTPs expressed and regulated in breast cancer cell lines during differentiation and identify one PTP, DEP-1, that inhibits the growth of breast cancer cells in vitro.

References
  • Holsinger LJ, et al. (2002) The transmembrane receptor protein tyrosine phosphatase DEP1 interacts with p120. Oncogene. 21(46): 7067-76.
  • Huang X, et al. (2009) Natural variation at the DEP1 locus enhances grain yield in rice. Nat Genet. 41(4): 494-7.
  • Kuramochi S, et al. (1996) Molecular cloning and characterization of Byp, a murine receptor-type tyrosine phosphatase similar to human DEP-1. FEBS Lett. 378(1): 7-14.
  • Size / Price
    Catalog: HG13165-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"