After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse IL25 / IL17E Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL25cDNA Clone Product Information
cDNA Size:549
cDNA Description:ORF Clone of Mus musculus interleukin 25 DNA.
Gene Synonym:Il17e, IL-17, IL-25
Restriction Site:HindIII + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

IL-17 Family & Receptor Related Products
Product nameProduct name
Canine IL17 / IL17A ProteinRat IL17RA / IL17R Protein (Fc Tag)Marmoset IL17 / IL17A ProteinHuman IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Human IL17 / IL17A ProteinHuman p38 alpha / MAPK14 Protein (Activated in vitro, His Tag)Canine IL-17RD Protein (Fc Tag)Cynomolgus IL17BR / IL17RB / IL-17 Receptor B Protein (ECD, His Tag)Human IL17B / IL-17B Protein (Fc Tag)Rat IL17F / IL-17F Protein (His Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human p38 alpha / MAPK14 Protein (His Tag)Human IL25 Protein (Fc Tag)Human IL17RD Protein (His Tag)Human p38 delta / MAPK13 Protein (GST Tag)Canine IL17RD Protein (His Tag)Human IL17RA / CD217 Protein (His & Fc Tag)Human IL17RA / CD217 Protein (His Tag)Human IL17 / IL17A Protein (His Tag)Human IL17RC Protein (Fc Tag)Human IL17RC Protein (aa 1-454, His Tag)Mouse IL17F / IL-17F Protein (His Tag)Mouse IL17F / IL-17F ProteinHuman IL-17F / Interleukin-17F Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Human IL17 / IL17A Protein (His Tag)Human IL17 / IL17A ProteinHuman RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Mouse IL17B / IL-17B Protein (Fc Tag)Human IL17RB / IL-17 Receptor B Protein (Flag Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Mouse IL25 Protein (His Tag)Mouse IL17RA / IL17R / CD217 Protein (Fc Tag)Mouse IL17RA / IL17R / CD217 Protein (His Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Mouse ERK2 / MAPK1 / MAPK2 ProteinMouse IL17 / IL17A ProteinMouse IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Human IL-17F / IL17F ProteinRat IL17RA / IL17R Protein (His Tag)Rat Interleukin 25 / IL25 / IL17E Protein (Fc Tag)Cynomolgus IL17RA / IL17R Protein (Fc Tag)Mouse IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)Human IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)

Interleukin-25 (IL-25) is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. IL-25 is a member of the IL-17 family of cytokines. However, unlike the other members of this family, IL-25 promotes T helper (Th) 2 responses. IL-25 also regulates the development of autoimmune inflammation mediated by IL-17–producing T cells. IL-25 and IL-17, being members of the same cytokine family, play opposing roles in the pathogenesis of organ-specific autoimmunity. IL-25 promotes cell expansion and Th2 cytokine production when Th2 central memory cells are stimulated with thymic stromal lymphopoietin (TSLP)–activated dendritic cells (DCs), homeostatic cytokines, or T cell receptor for antigen triggering. Elevated expression of IL-25 and IL-25R transcripts was observed in asthmatic lung tissues and atopic dermatitis skin lesions, linking their possible roles with exacerbated allergic disorders. A plausible explanation that IL-25 produced by innate effector eosinophils and basophils may augment the allergic inflammation by enhancing the maintenance and functions of adaptive Th2 memory cells had been provided.

  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Tamachi T, et al.. (2006) IL-25 enhances allergic airway inflammation by amplifying a TH2 cell-dependent pathway in mice. J Allergy Clin Immunol. 118(3): 606-14.
  • Kleinschek MA, et al.. (2007) IL-25 regulates Th17 function in autoimmune inflammation. J Exp Med. 204(1): 161-70.