Quick Order

Text Size:AAA

Human LAIR2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LAIR2 cDNA Clone Product Information
NCBI RefSeq:NM_002288.3
RefSeq ORF Size:459bp
cDNA Description:Full length Clone DNA of Homo sapiens leukocyte-associated immunoglobulin-like receptor 2 with N terminal HA tag.
Gene Synonym:CD306, MGC71634
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Leukocyte-associated immunoglobulin-like receptor 2 ( LAIR2 ), also known as CD306, is a 131 amino acid protein containing one lg-like C2-type domain. It is expressed as a soluble receptor exhibiting high affinity for various collagen molecules to which it binds in a hydroxyproline-dependent manner. LAIR2 is a member of the immunoglobulin superfamily and was identified by its similarity to LAIR1, an inhibitory receptor present on mononuclear leukocytes. LAIR2 is thought to be secreted and may help modulate mucosal tolerance. As a natural competitor for LAIR1, soluble LAIR2 prevents binding of human LAIR1 to collagens and LAIR1 cross-linking, thereby regulating its inhibitory potential. Accordingly, LAIR2 is suggested to perform an immunoregulatory function.

References
  • Meyaard, L. et al.,1997, Immunity.7:283-290.
  • Meyaard, L. et al.,1999, J. Immunol. 162:5800-5804.
  • Meyaard, L. et al., 2001,  J. Exp. Med. 194 (1): 107-112.
  • Meyaard, L., 2003, J Biol Regul Homeost Agents.  17 (4): 330-333.
  • Lebbink, R. J. et al., 2008, J Immunol. 180 (3):1662-1669.
  • Lebbink,R.J. et al., 2009,  Matrix Biol.  28 (4):202-210.
  • Size / Price
    Catalog: HG10868-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"