Quick Order

Text Size:AAA

Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HDAC8cDNA Clone Product Information
cDNA Size:1134
cDNA Description:ORF Clone of Homo sapiens histone deacetylase 8 DNA.
Gene Synonym:RPD3, HDACL1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10864-ACG$325
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10864-ACR$325
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10864-ANG$325
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10864-ANR$325
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10864-CF$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10864-CH$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10864-CM$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10864-CY$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone)HG10864-M$95
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10864-M-F$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10864-M-N$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10864-NF$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10864-NH$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10864-NM$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10864-NY$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10864-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Histone deacetylase 8, also known as HDAC8 and HDACL1, is a nucleus and cytoplasm protein which belongs to the histone deacetylase family and HD type 1 subfamily. Histone deacetylases (HDACs) are a growing family of enzymes implicated in transcriptional regulation by affecting the acetylation state of core histones in the nucleus of cells. HDAC8 / HDACL1 is weakly expressed in most tissues. It expressed at higher level in heart, brain, kidney and pancreas and also in liver, lung, placenta, prostate and kidney. HDAC8 / HDACL1 is responsible for the deacetylation of lysine residues on the N-terminal part of the core histones ( H2A, H2B, H3 and H4 ). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. HDAC8 / HDACL1 may play a role in smooth muscle cell contractility. HDAC8 / HDACL1 may be a potential drug target for neuroblastoma differentiation therapy using selective inhibitors, avoiding unspecific side effects.

  • Buggy JJ. et al.,2000, Biochem J. 350 (1): 199-205.
  • Krennhrubec K. et al., 2007, Bioorg Med Chem Lett. 17 (10): 2874-8.
  • Oehme I. et al., 2009, Expert Opin Investig Drugs.18 (11): 1605-17.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items