After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human EEF1E1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human EEF1E1 cDNA Clone Product Information
Gene_bank_ref_id:BC005291
RefSeq ORF Size:525bp
cDNA Description:Full length Clone DNA of Homo sapiens eukaryotic translation elongation factor 1 epsilon 1 with N terminal His tag.
Gene Synonym:P18, AIMP3, EEF1E1
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

EEF1E1, also known as AIMP3 and p18, is a multifunctional protein that localizes to both the cytoplasm and nucleus. In the cytoplasm, EEF1E1 is an auxiliary component of the macromolecular aminoacyl-tRNA synthase complex. It is comprised of a bifunctional glutamyl-prolyl-tRNA synthase, the monospecific isoleucyl, leucyl, glutaminyl, methionyl, lysyl, arginyl and aspartyl-tRNA synthases, and three auxiliary proteins, EEF1E1/p18, AIMP2/p38 and AIMP1/p43. EEF1E1 also plays a positive role in ATM/ATR-mediated p53 activation.

References
  • Mao M. et al., 1998, Proc Natl Acad Sci. 95 (14): 8175-80.
  • Quevillon S. et al., 1999, J Mol Biol. 285 (1): 183-95.
  • Ahn HC. et al., 2003, FEBS Lett. 542 (1-3): 119-24.
  • Size / Price
    Catalog: HG14004-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"