Quick Order

Text Size:AAA

Mouse SERPIND1 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SERPIND1 cDNA Clone Product Information
Gene_bank_ref_id:NM_008223.3
RefSeq ORF Size:1437bp
cDNA Description:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade D, member 1 with C terminal Flag tag.
Gene Synonym:HCII, Hcf2, AA985900, AI303446, MGC107662
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse SERPIND1 Gene Expression validated Image
[Click to enlarge image]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Mouse SERPIND1 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

SerpinD1, also known as heparin cofactor II (HCâ…¡), is a member of Serpin superfamily of the serine proteinase inhibitors. HCII is a glycoprotein in human plasma that inhibits thrombin and chymotrypsin, and the rate of inhibition of thrombin is rapidly increased by Dermatan sulfate (DS), heparin (H) and glycosaminoglycans(GAG). The stimulatory effect of glycosaminoglycans on the inhibition is mediated, in part, by the N-terminal acidic domain of HCII. Interestingly, a C-terminal His-tagged recombinant HCII exhibits enhanced activity of thrombin inhibition. It has been suggested that HCII plays an unique and important role in vascular homeostasis, and accordingly mutations in this gene or congenital HCII deficiency is potentially associated with thrombosis. HCII specifically inhibits thrombin action at the site of vascular wall injury and HCII-thrombin complexes have been detected in human plasma. HCII protects against thrombin-induced vascular remodeling in both humans and mice and suggest that HCII is a predictive biomarker and therapeutic target for atherosclerosis. SerpinD1 also inhibits chymotrypsin, but in a glycosaminoglycan-independent manner.

References
  • Rau JC, et al. (2009) Heparin cofactor II in atherosclerotic lesions from the Pathobiological Determinants of Atherosclerosis in Youth (PDAY) study. Exp Mol Pathol. 87(3): 178-83.
  • Aihara K, et al. (2009) Heparin cofactor II as a novel vascular protective factor against atherosclerosis. J Atheroscler Thromb. 16(5): 523-31.
  • Size / Price
    Catalog: MG50121-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"