Quick Order

Mouse TWSG1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TWSG1cDNA Clone Product Information
cDNA Size:669
cDNA Description:ORF Clone of Mus musculus twisted gastrulation homolog 1 (Drosophila) DNA.
Gene Synonym:Tsg, Twg, AW552143, D17Ertd403e, 1810013J15Rik, 9030422N06Rik, Twsg1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

TWSG1 belongs to the twisted gastrulation protein family. TWSG1 from different species are functionally equivalent. In contrast to Drosophila where TWSG1 expression is limited to early embryos, expression of TWSG1 is found throughout mouse and human development. Mutations in the TWSG1 gene cause at least some of the cells on the dorsal half of the embryo to adopt more ventral cell fates. This is thought to involve gradients of the signaling molecule decapentaplegic. TWSG1 may function as a bone morphogenetic protein signalling agonist or antagonize these activities. It can dislodge latent bone morphogenetic proteins and thus provides a permissive signal that allows high BMP signaling in the embryo. TWSG1 is a cofactor in the antagonism of chordin to BMP signaling. It also binds both the vertebrate Decapentaplegic ortholog BMP4 and chordin and forms ternary complexes. Meanwhile, TWSG1 increases binding of chordin to BMP4, potentiates the ability of chordin to induce secondary axes in Xenopus embryos, and enhances chordin cleavage by vertebrate proteases related to tolloid at a site poorly used in the absence of TWSG1. The presence of TWSG1 enhances the secondary axis-inducing activity of 2 products of chordin cleavage.

  • Tzachanis D, et al. (2007) Twisted gastrulation (Tsg) is regulated by Tob and enhances TGF-beta signaling in activated T lymphocytes. J Immunol. Blood. 109 (7): 2944-52.
  • Tanno T, et al. (2009) Identification of TWSG1 as a second novel erythroid regulator of hepcidin expression in murine and human cells. Blood. 114 (1): 181-6.
  • Kauvar EF, et al. (2011) Minimal evidence for a direct involvement of twisted gastrulation homolog 1 (TWSG1) gene in human holoprosencephaly. Mol Genet Metab. 102 (4): 470-80.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items