After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human DEFB103A ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DEFB103A cDNA Clone Product Information
NCBI RefSeq:NM_018661.3
RefSeq ORF Size:204bp
cDNA Description:Full length Clone DNA of Homo sapiens defensin, beta 103A with N terminal HA tag.
Gene Synonym:DEFB103A
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Beta-defensin 3 is a member of the defensin family. Defensin family is comprised by microbicidal and cytotoxic peptides made by neutrophils. Members of the beta-defensin 3 family are highly similar in protein sequence. Beta-defensin 3 shows antimicrobial activity against Gram-positive bacteria S.aureus and S.pyogenes, Gram-negative bacteria P.aeruginosa and E.coli and the yeast C.albicans. Beta-defensin 3 is abundantly expressed in skin and tonsils, and to a lesser extent in trachea, uterus, kidney, thymus, adenoid, pharynx and tongue. It is also expressed in salivary gland, bone marrow, colon, stomach, polyp and larynx. However, in small intestine, it cannot be detected. Defensin has broad spectrum antimicrobial activity and may play an important role in innate epithelial defense. Beta-defensin 3 kills multiresistant S.aureus and vancomycin-resistent E.faecium. It has no significant hemolytic activity.

References
  • Garca JR, et al. (2002) Identification of a novel, multifunctional beta-defensin (human beta-defensin 3) with specific antimicrobial activity. Its interaction with plasma membranes of Xenopus oocytes and the induction of macrophage chemoattraction. Cell Tissue Res. 306(2):257-64.
  • Dunsche A, et al. (2002) The novel human beta-defensin-3 is widely expressed in oral tissues. Eur J Oral Sci. 110(2):121-4.
  • Abiko Y, et al. (2004) Upregulated expression of human beta defensin-1 and -3 mRNA during differentiation of keratinocyte immortalized cell lines, HaCaT and PHK16-0b. J Dermatol Sci. 31(3): 225-8.
  • Size / Price
    Catalog: HG10849-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"