After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse PLAUR Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PLAURcDNA Clone Product Information
cDNA Size:984
cDNA Description:ORF Clone of Mus musculus plasminogen activator, urokinase receptor DNA.
Gene Synonym:Cd87, uPAR, u-PAR, Plaur
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Urokinase plasminogen activator (uPA) and/or its receptor (uPAR) are essential for metastasis, and overexpression of these molecules is strongly correlated with poor prognosis in a variety of malignant tumours. uPAR and uPA levels in both resected tumor tissue and plasma are of independent prognostic significance for patient survival in several types of human cancer. This system has classically been thought to drive tumor progression by mediating directed extracellular proteolysis on the surface of migrating or invading cells, and intervening with this proteolysis by targeting uPAR has been proposed to represent a novel approach for inhibiting tumor progression. uPAR, also known as PLAUR or CD87, has been implicated in the growth, metastasis, and angiogenesis of several solid and hemotologic malignancies. uPAR is a highly glycosylated, 55-60kDa integral membrane protein linked to the plasma membrane by a glycosylphosphatidylinositol (GPI) anchor. It is part of a cell surface system that also consists of the serine protease uPA and several specific inhibitors (plasminogen activator inhibitors 1 and 2). Additionally, the analysis of CD87 (urokinase-type plasminogen activator receptor - uPAR) expression has a potential role in the diagnostic or prognostic work-up of several hematological malignancies, particularly acute leukemia and multiple myeloma.

  • Romer J, et al. (2004) The urokinase receptor as a potential target in cancer therapy. Curr Pharm Des. 10(19): 2359-76.
  • Bn MC, et al. (2004) CD87 (urokinase-type plasminogen activator receptor), function and pathology in hematological disorders: a review. Leukemia. 18(3): 394-400.
  • Pillay V, et al. (2007) The urokinase plasminogen activator receptor as a gene therapy target for cancer. Trends Biotechnol. 25(1): 33-9.
  • Mazar AP. (2008) Urokinase plasminogen activator receptor choreographs multiple ligand interactions: implications for tumor progression and therapy. Clin Cancer Res. 14(18): 5649-55.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items