After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
YWHAQcDNA Clone Product Information
Gene_bank_ref_id:NM_006826.2
cDNA Size:738
cDNA Description:ORF Clone of Homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide DNA.
Gene Synonym:1C5, HS1, 14-3-3
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
 
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10845-ACG$325
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10845-ACR$325
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10845-ANG$325
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10845-ANR$325
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10845-CF$295
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10845-CH$295
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10845-CM$295
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10845-CY$295
Human YWHAQ Gene cDNA Clone (full-length ORF Clone)HG10845-M$95
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10845-M-F$295
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10845-M-N$295
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, HA-taggedHG10845-M-Y$295
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10845-NF$295
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10845-NH$295
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10845-NM$295
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10845-NY$295
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10845-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
References
  • Cheng Y, et al. (2010) Effect of 14-3-3 tau protein on differentiation in BeWo choriocarcinoma cells. Placenta. 31(1): 60-6.
  • Umahara T, et al. (2010) 14-3-3 proteins and spinocerebellar ataxia type 1: from molecular interaction to human neuropathology. Cerebellum. 9(2): 183-9.
  • Wang B, et al. (2004) A role for 14-3-3 tau in E2F1 stabilization and DNA damage-induced apoptosis. J Biol Chem. 279(52): 54140-52.
  • Size / Price
    Catalog:HG10845-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"