After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse APCS / SAP Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
APCScDNA Clone Product Information
Gene Bank Ref.ID:NM_011318.1
cDNA Size:675
cDNA Description:ORF Clone of Mus musculus serum amyloid P-component DNA.
Gene Synonym:Sap
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Serum amyloid P component (SAP) is the identical serum form of amyloid P component (AP), a highly preserved plasma protein named for its ubiquitous presence in amyloid deposits. As a normal plasma protein first identified as the pentagonal constituent of in vivo pathological deposits called "amyloid". Serum amyloid P component represents another member of the pentraxin family, a highly conserved group of molecules that may play a role in innate immunity. SAP is a key negative regulator for innate immune responses to DNA and may be partly responsible for the insufficient immune responses after DNA vaccinations in humans. SAP suppression may be a novel strategy for improving efficacy of human DNA vaccines and requires further clinical investigations.

  • Wang Y, et al. (2011) Human serum amyloid P functions as a negative regulator of the innate and adaptive immune responses to DNA vaccines. J Immunol. 186(5): 2860-70.
  • Hawkins PN. (2002) Serum amyloid P component scintigraphy for diagnosis and monitoring amyloidosis. Curr Opin Nephrol Hypertens. 11(6): 649-55.
  • Noursadeghi M, et al. (2000) Role of serum amyloid P component in bacterial infection: protection of the host or protection of the pathogen. Proc Natl Acad Sci U S A. 97: 14584-9.
  • de Haas CJ. (1999) New insights into the role of serum amyloid P component, a novel lipopolysaccharide-binding protein. FEMS Immunol Med Microbiol. 26(3-4): 197-202.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:2-3 weeks