Quick Order

Human Soggy-1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DKKL1cDNA Clone Product Information
cDNA Size:729
cDNA Description:ORF Clone of Homo sapiens dickkopf-like 1 (soggy) DNA.
Gene Synonym:SGY, SGY1, SGY-1, DKKL1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Dickkopf-like 1 (DKKL1) or soggy 1, is a glycoprotein unique to mammals that is expressed primarily in developing spermatocytes and localized in the acrosome of mature sperm. It is also expressed in the trophectoderm / placental lineage. This glycoprotein is secreted by postmeiotic male germ cells. DKKL1 is a member of the Dickkopf (DKK) family, a group of proteins that are characterized as secreted antagonists of Wnt signal transduction proteins. In mammals, embryos lacking DKKL1 protein developed into viable, fertile adults. DKKL1, either directly or indirectly, facilitates the ability of sperm to penetrate the zona pellucid. DKKL1 is related to the sperm apoptotic procession. Molecular analyses identified the Fas death ligand (FasL) as a target for DkkL1 pro-apoptotic activity in adult mice. DKKL1 is considered as a negative regulator of adult testic homeostasis and identifies a novel, DKKL1 / FasL- dependent, regulation that specifically controls the number of postpubertal spermatocytes. 

  • Niehrs C. (2006) Function and biological roles of the Dickkopf family of Wnt modulators. Oncogene. 25 (57): 7469-81.
  • Kohn MJ, et al. (2010) The Acrosomal Protein Dickkopf-Like 1 (DKKL1) Facilitates Sperm Penetration Of The Zona Pellucida. Fertil Steril. 93 (5): 1533-7.
  • KOHN MJ, et al. (2005) DKKL1 (Soggy), A Dickkopf Family Member, Localizes to the Acrosome During Mammalian Spermatogenesis. Mol Reprod Dev. 71 (4): 516-22.