Quick Order

Text Size:AAA

Human CGB7 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CGB7 cDNA Clone Product Information
Gene_bank_ref_id:NM_033043.1
RefSeq ORF Size:498
cDNA Description:ORF Clone of Homo sapiens chorionic gonadotropin, beta polypeptide 7 DNA.
Gene Synonym:FLJ35403, FLJ43118, CG-beta-a, CGB7
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CGB7 (chorionic gonadotropin, beta polypeptide 7) belongs to the glycoprotein hormones subunit beta family. Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. CGB7 gene is a member of the glycoprotein hormone beta chain family and encodes the beta 7 subunit of chorionic gonadotropin (CG). CG is produced by the trophoblastic cells of the placenta and stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy. The beta subunit of CG is encoded by 6 genes which are arranged in tandem and inverted pairs on chromosome 19q13.3 and contiguous with the luteinizing hormone beta subunit gene. CGB7 is used as adjunctive therapy in the treatment of obesity. CGB7 also stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"