After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SEZ6L2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SEZ6L2 cDNA Clone Product Information
Gene_bank_ref_id:BC000567
RefSeq ORF Size:2430bp
cDNA Description:Full length Clone DNA of Homo sapiens seizure related 6 homolog (mouse)-like 2 with N terminal His tag.
Gene Synonym:PSK-1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

SEZ6L2, also known as PSK-1, belongs to the SEZ6 family. It contains 3 CUB domains and 5 Sushi (CCP/SCR) domains. SEZ6L2 may contribute to specialized endoplasmic reticulum functions in neurons.SEZ6L2 presents on the surface of lung-cancer cells. SEZ6L2 should be a useful prognostic marker of lung cancers. Increased expression of this gene has been found in lung cancers, and the protein is therefore considered to be a novel prognostic marker for lung cancer.

References
  • Bedoyan JK. et al., 2010, Am J Med Genet A. 152A (6): 1567-74.
  • Konyukh M. et al., 2011, PLoS One. 6 (3): e17289.
  • Wang J. et al., 2011, Mol Syst Biol. 7: 536.
  • Size / Price
    Catalog: HG13969-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"