After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse IL6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL6cDNA Clone Product Information
cDNA Size:654
cDNA Description:ORF Clone of Mus musculus interleukin 6 DNA.
Gene Synonym:IL-6
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

IL-6 Family & Receptor Related Products
Product nameProduct name
Rat GM-CSF / CSF2 Protein (Fc Tag)Mouse Oncostatin M / OSM ProteinHuman Interleukin-31 receptor A / IL31RA Protein (Fc Tag, ECD)Canine IL-6R / CD126 Protein (ECD, His Tag)Human Oncostatin M / OSM ProteinCanine IL11RA / IL-11RA Protein (Fc Tag)Human G-CSF / CSF3 Protein (isoform b)Rat IL-11RA1 / Il11RA1 Protein (His Tag)Mouse CNTF / Ciliary Neurotrophic Factor Protein (His Tag)Human NNT1 / CLCF1 / CLC Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human GM-CSF / CSF2 Protein (His Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 Protein (His Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman Leptin ProteinHuman IL11RA / IL11Rα Protein (His Tag)Human Leptin Receptor / LEPR / CD295 Protein (His & Fc Tag)Human Leptin Receptor / LEPR / CD295 Protein (His Tag)Human IL6 / Interleukin-6 ProteinHuman IL6R / CD126 Protein (His Tag)Human Oncostatin M / OSM Protein (His Tag)Human LIFR / CD118 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Human IL6ST / gp130 / CD130 ProteinHuman CNTFR / CNTFR-alpha Protein (His Tag)Human OSMR / IL31RB Protein (His Tag)Mouse IL-31 / IL31 Protein (His Tag)Human CNTF Protein (His Tag)Human IL11 / Interleukin 11 / IL-11 ProteinRat IL-6R / CD126 Protein (ECD, His Tag)Human G-CSF / CSF3 Protein (isoform b)Human LIF Protein (Fc Tag)Human LIF Protein (His Tag)Mouse IL11RA / IL11Rα Protein (His Tag)Mouse Oncostatin M / OSM Protein (His Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Mouse IL6 / Interleukin-6 ProteinMouse IL6RA / CD126 Protein (His Tag)Mouse LIFR / CD118 Protein (His Tag)Mouse OSMR / IL-31RB Protein (His Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Human GM-CSF / CSF2 ProteinRat CNTF / Ciliary Neurotrophic Factor ProteinRat CNTFR / CNTFR-alpha Protein (His Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Human GM-CSF / CSF2 ProteinRat IL6 / Interleukin-6 ProteinCanine IL11RA / IL-11RA / IL11Rα Protein (His Tag)Rat LIFR Protein (His Tag)Human LIF ProteinHuman IL-31 / IL31 Protein (His Tag)Cynomolgus / Rhesus IL6 / Interleukin-6 ProteinCynomolgus IL6ST / gp130 Protein (Fc Tag)Cynomolgus IL6ST / gp130 Protein (His Tag)Mouse GM-CSF / CSF2 ProteinMouse IL-11 / interleukin 11 ProteinSus scrofa (pig) IL6 / IL-6 ProteinRat IL-6R / CD126 Protein (Fc Tag, ECD)Human Interleukin-31 receptor A / IL31RA Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Canine IL11RA / IL-11RA / IL11Rα Protein

Interleukin-6 (IL-6) is a multifunctional α-helical cytokine that regulates cell growth and differentiation of various tissues, which is known particularly for its role in the immune response and acute phase reactions. IL-6 protein is secreted by a variety of cell types including T cells and macrophages as phosphorylated and variably glycosylated molecule. It exerts actions through the its heterodimeric receptor composed of IL-6R that lacks the tyrosine/kinase domain and binds IL-6 with low affinity, and ubiquitously expressed glycoprotein 130 (gp130) that binds the IL-6. IL-6R complex with high affinity and thus transduces signals. IL-6 is also involved in hematopoiesis, bone metabolism, and cancer progression, and has been defined an essential role in directing transition from innate to acquired immunity.

  • Heinrich PC. et al. (2003). Principles of interleukin-6-type cytokine signalling and its regulation. Biochem J. 374: 1-20.
  • Rose-John S, et al. (2007) The IL-6/sIL-6R complex as a novel target for therapeutic approaches. Expert Opin Ther Targets. 11(5): 613-24.
  • Dinh W, et al. (2009) Elevated plasma levels of TNF-alpha and interleukin-6 in patients with diastolic dysfunction and glucose metabolism disorders. Cardiovasc Diabetol. 8:58.