After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse IL6ST Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL6STcDNA Clone Product Information
Gene_bank_ref_id:NM_010560.2
cDNA Size:2754
cDNA Description:ORF Clone of Mus musculus interleukin 6 signal transducer DNA.
Gene Synonym:CD130, gp130, AA389424, BB405851, D13Ertd699e, 5133400A03Rik, Il6st
Species:Mouse
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

IL-6 Family & Receptor Related Products
Product nameProduct name
Rat GM-CSF / CSF2 Protein (Fc Tag)Mouse Oncostatin M / OSM ProteinHuman Interleukin-31 receptor A / IL31RA Protein (Fc Tag, ECD)Canine IL-6R / CD126 Protein (ECD, His Tag)Human Oncostatin M / OSM ProteinCanine IL11RA / IL-11RA Protein (Fc Tag)Human G-CSF / CSF3 Protein (isoform b)Rat IL-11RA1 / Il11RA1 Protein (His Tag)Mouse CNTF / Ciliary Neurotrophic Factor Protein (His Tag)Human NNT1 / CLCF1 / CLC Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human GM-CSF / CSF2 Protein (His Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 Protein (His Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman Leptin ProteinHuman IL11RA / IL11Rα Protein (His Tag)Human Leptin Receptor / LEPR / CD295 Protein (His & Fc Tag)Human Leptin Receptor / LEPR / CD295 Protein (His Tag)Human IL6 / Interleukin-6 ProteinHuman IL6R / CD126 Protein (His Tag)Human Oncostatin M / OSM Protein (His Tag)Human LIFR / CD118 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Human IL6ST / gp130 / CD130 ProteinHuman CNTFR / CNTFR-alpha Protein (His Tag)Human OSMR / IL31RB Protein (His Tag)Mouse IL-31 / IL31 Protein (His Tag)Human CNTF Protein (His Tag)Human IL11 / Interleukin 11 / IL-11 ProteinRat IL-6R / CD126 Protein (ECD, His Tag)Human G-CSF / CSF3 Protein (isoform b)Human LIF Protein (Fc Tag)Human LIF Protein (His Tag)Mouse IL11RA / IL11Rα Protein (His Tag)Mouse Oncostatin M / OSM Protein (His Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Mouse IL6 / Interleukin-6 ProteinMouse IL6RA / CD126 Protein (His Tag)Mouse LIFR / CD118 Protein (His Tag)Mouse OSMR / IL-31RB Protein (His Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Human GM-CSF / CSF2 ProteinRat CNTF / Ciliary Neurotrophic Factor ProteinRat CNTFR / CNTFR-alpha Protein (His Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Human GM-CSF / CSF2 ProteinRat IL6 / Interleukin-6 ProteinCanine IL11RA / IL-11RA / IL11Rα Protein (His Tag)Rat LIFR Protein (His Tag)Human LIF ProteinHuman IL-31 / IL31 Protein (His Tag)Cynomolgus / Rhesus IL6 / Interleukin-6 ProteinCynomolgus IL6ST / gp130 Protein (Fc Tag)Cynomolgus IL6ST / gp130 Protein (His Tag)Mouse GM-CSF / CSF2 ProteinMouse IL-11 / interleukin 11 ProteinSus scrofa (pig) IL6 / IL-6 ProteinRat IL-6R / CD126 Protein (Fc Tag, ECD)Human Interleukin-31 receptor A / IL31RA Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Canine IL11RA / IL-11RA / IL11Rα Protein
Background

Glycoprotein 130 (also known as gp130, IL6ST, IL6-beta or CD130) is a transmembrane protein which is the founding member of the class of all cytokine receptors. CD130/gp130 is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and Oncostatin M (OSM). CD130/gp130 functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. CD130/gp130 plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A related pseudogene has been identified on chromosome 17. The receptor systems for IL6, LIF, OSM, CNTF, IL11, CTF1 and BSF3 can utilize gp130 for initiating signal transmission. CD130/gp130 binds to IL6/IL6R (alpha chain) complex, resulting in the formation of high-affinity IL6 binding sites, and transduces the signal. CD130/gp130 may have a role in embryonic development. The type I OSM receptor is capable of transducing OSM-specific signaling events.

References
  • Hibi, et al. (1990) Molecular cloning and expression of an IL-6 signal transducer, gp130. Cell. 63 (6): 1149-57.
  • Kim H, et al. (1997) Transmembrane domain of gp130 contributes to intracellular signal transduction in hepatic cells. J Biol Chem. 272 (49): 30741-7.
  • Giordano V, et al. (1997) Shc mediates IL-6 signaling by interacting with gp130 and Jak2 kinase. J Immunol. 158 (9): 4097-103.
  • Size / Price
    Catalog:MG50135-NF
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"