After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human B3GALTL ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human B3GALTL cDNA Clone Product Information
Gene_bank_ref_id:NM_194318.3
RefSeq ORF Size:1497bp
cDNA Description:Full length Clone DNA of Homo sapiens beta 1,3-galactosyltransferase-like with N terminal His tag.
Gene Synonym:B3GTL, Gal-T, B3GLCT, B3Glc-T, beta3Glc-T
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

B3GALTL is a beta-1,3-glucosyltransferase that transfers glucose to O-linked fucosylglycans on thrombospondin type-1 repeats (TSRs) of several proteins. B3GALTL is a type II membrane protein. Defects in B3GALTL gene are a cause of Peters-plus syndrome (PPS). As an O-fucosyltransferase, B3GALTL transfers glucose toward fucose with a beta-1,3 linkage. It specifically glucosylates O-linked fucosylglycan on TSP type-1 domains of proteins, thereby contributing to elongation of O-fucosylglycan.

References
  • Heinonen TY. et al., 2003, Biochem Biophys Res Commun. 309 (1): 166-74.
  • Sato T. et al., 2006, Glycobiology. 16 (12): 1194-206.
  • Kozma K. et al., 2006, J Biol Chem. 281 (48): 36742-51.
  • Size / Price
    Catalog: HG13957-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"