After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse NRN1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse NRN1 cDNA Clone Product Information
Gene_bank_ref_id:NM_153529.2
RefSeq ORF Size:429bp
cDNA Description:Full length Clone DNA of Mus musculus neuritin 1 with C terminal Myc tag.
Gene Synonym:Nrn, Cpg15, 0710008J23Rik
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Neuritin 1 (NRN1) is a member of neuritin family. Neuritin is a glycosylphosphatidylinositol- anchored protein induced by neural activity. It is expressed in postmitotic-differentiating neurons of the developing nervous system and a population of small-diameter neurons in the dorsal root ganglia and was anterogradely and retrogradely transported. Neuritin message is induced by neuronal activity and by the activity-regulated neurotrophins BDNF, nerve growth factor (NGF) and NT-3. Purified recombinant neuritin promotes neurite outgrowth and arborization in primary embryonic hippocampal and cortical cultures. Thus, neuritin is considered as a downstream effector of activity-induced neurite outgrowth. In clinical, neuritin levels in diabetes were reduced in both dorsal root ganglia and sciatic nerve of rats, and these deficits were reversed in vivo by treatment with NGF. This manipulation of neuritin levels in diabetes may provide a potential target for the therapeutic intervention in the management of neuropathy.

References
  • Karamoysoyli E, et al. (2008) Neuritin mediates nerve growth factor-induced axonal regeneration and is deficient in experimental diabetic neuropathy. Diabetes. 57(1): 181-9.
  • Naeve GS, et al. (1997) Neuritin: A gene induced by neural activity and neurotrophins that promotes neuritogenesis. Proc Natl Acad Sci U S A. 94(6): 2648-2653.
  • Kojima N, et al. (2005) Expression of neuritin during liver maturation and regeneration. FEBS Lett. 579(21): 4562-6.
  • Size / Price
    Catalog: MG52152-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"