Quick Order

Text Size:AAA

Human TSPAN1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TSPAN1 cDNA Clone Product Information
Gene_bank_ref_id:NM_005727.3
RefSeq ORF Size:726bp
cDNA Description:Full length Clone DNA of Homo sapiens tetraspanin 1 with C terminal HA tag.
Gene Synonym:NET1, TM4C, TM4SF, TSPAN1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

TSPAN1 belongs to the transmembrane 4 superfamily, also known as the tetraspanin family. Tetraspanins have four hydrophobic domains, intracellular N- and C-termini and two extracellular domains. Tetraspanins act as scaffolding proteins, anchoring multiple proteins to one area of the cell membrane. They also mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. TSPAN1 interacts with human thiamine transporter-1 (hTHTR-1). HTHTR-1 contributes to intestinal thiamine uptake, and its function is regulated at both the transcriptional and posttranscriptional levels. TSPAN1 and hTHTR-1 colocalize in human intestinal epithelial HuTu-80 cells. Coexpression of TSPAN1 in these cells led to a significant decrease in the rate of degradation of hTHTR-1 compared with cells expressing the hTHTR-1 alone; in fact the half-life of the TSPAN1 protein was twice longer in the former cell type compared with the latter cell type.

References
  • Chen L. et al., 2010, J Korean Med Sci. 25 (10): 1438-42.
  • Chen L. et al., 2010, Tumori. 96 (5): 744-50.
  • Nabokina SM. et al., 2011, Am J Physiol Gastrointest Liver Physiol. 301 (5): G808-13.
  • Size / Price
    Catalog: HG13073-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"