Quick Order

Text Size:AAA

Human MAPK8 transcript variant JNK1-b2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MAPK8 cDNA Clone Product Information
Gene_bank_ref_id:NM_001278547.1
RefSeq ORF Size:1284bp
cDNA Description:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 8, transcript variant JNK1-b2 with N terminal HA tag.
Gene Synonym:JNK, JNK1, PRKM8, SAPK1, JNK1A2, JNK21B1/2
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human MAPK8 transcript variant JNK1-b2 ORF mammalian expression plasmid, N-HA tag on other vectors
Human MAPK8 transcript variant JNK1-b2 ORF mammalian expression plasmid, C-GFPSpark tagHG10795-ACG$325
Human MAPK8 transcript variant JNK1-b2 ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10795-ACR$325
Human MAPK8 transcript variant JNK1-b2 ORF mammalian expression plasmid, N-GFPSpark tagHG10795-ANG$325
Human MAPK8 transcript variant JNK1-b2 ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10795-ANR$325
Human MAPK8 transcript variant JNK1-b2 ORF mammalian expression plasmid, C-Flag tagHG10795-CF$295
Human MAPK8 transcript variant JNK1-b2 ORF mammalian expression plasmid, C-His tagHG10795-CH$295
Human MAPK8 transcript variant JNK1-b2 ORF mammalian expression plasmid, C-Myc tagHG10795-CM$295
Human MAPK8 transcript variant JNK1-b2 ORF mammalian expression plasmid, C-HA tagHG10795-CY$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA clone plasmidHG10795-M$95
Human MAPK8 transcript variant JNK1-b2 ORF mammalian expression plasmid, Flag tagHG10795-M-F$295
Human MAPK8 transcript variant JNK1-b2 natural ORF mammalian expression plasmidHG10795-M-N$295
Human MAPK8 transcript variant JNK1-b2 ORF mammalian expression plasmid, N-Flag tagHG10795-NF$295
Human MAPK8 transcript variant JNK1-b2 ORF mammalian expression plasmid, N-His tagHG10795-NH$295
Human MAPK8 transcript variant JNK1-b2 ORF mammalian expression plasmid, N-Myc tagHG10795-NM$295
Human MAPK8 transcript variant JNK1-b2 ORF mammalian expression plasmid, N-HA tagHG10795-NY$295
Human MAPK8 transcript variant JNK1-b2 natural ORF mammalian expression plasmidHG10795-UT$295
 Learn more about expression Vectors
Product nameProduct name
Background

Mitogen-activated protein kinase 8 (MAPK8), also known as JNK1, is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The protein kinases JNK1 has been found to serve as critical molecular links between obesity, metabolic inflammation, and disorders of glucose homeostasis. It is critically involved in the promotion of diet-induced obesity, metabolic inflammation and beta-cell dysfunction. The selective deficiency of JNK1 in the murine nervous system is sufficient to suppress diet-induced obesity. Genetic analysis indicates that the effects of JNK1 can be separated from effects of JNK1 on obesity. JNK1 is a potential pharmacological target for the development of drugs that might be useful for the treatment of metabolic syndrome, and type 2 diabetes. Furthermore, JNK1 plays a major role in the hypoxic cellular damage. JNK1 protein might be an attractive target for antihypoxic therapy in increasing resistance to many pathological conditions and diseases, leading to the oxygen deficit.

References
  • Betigeri S, et al. (2006) JNK1 as a molecular target to limit cellular mortality under hypoxia. Mol Pharm. 3(4): 424-30.
  • Solinas G, et al. (2010) JNK1 and IKKbeta: molecular links between obesity and metabolic dysfunction. FASEB J. 24(8): 2596-611.
  • Sabio G, et al. (2010) Role of the hypothalamic-pituitary-thyroid axis in metabolic regulation by JNK1. Genes Dev. 24(3): 256-64.
  • Size / Price
    Catalog: HG10795-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"