Quick Order

Text Size:AAA

Mouse MCSFR / CSF1R Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSF1RcDNA Clone Product Information
cDNA Size:2934
cDNA Description:ORF Clone of Mus musculus colony stimulating factor 1 receptor DNA.
Gene Synonym:Fms, CD115, Csfmr, Fim-2, CSF-1R, M-CSFR, AI323359, Csf1r?
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Colony-Stimulating Factor (CSF) & Receptor Related Products

M-CSFR encoded by the proto-oncogene c-fms is the receptor for colony stimulating factor 1 (CSF1R), a cytokine involved in the proliferation, differentiation, and activation of macrophages. This cell surface glycoprotein is consisted by an extracellular ligand-binding domain, a single membrane-spanning segment, and an intracellular tyrosine kinase domain. Binding of CSF1 activates the receptor kinase, leading to "autophosphorylation" of receptor subunits and the concomitant phosphorylation of a series of cellular proteins on tyrosine residues. CSF1R is a tyrosine kinase receptor that is absolutely required for macrophage differentiation and thus occupies a central role in hematopoiesis. CSF1 and its receptor (CSF1R, product of c-fms proto-oncogene) were initially implicated as essential for normal monocyte development as well as for trophoblastic implantation. This apparent role for CSF1/CSF1R in normal mammary gland development is very intriguing because this receptor/ligand pair has also been found to be important in the biology of breast cancer in which abnormal expression of CSF1 and its receptor correlates with tumor cell invasiveness and adverse clinical prognosis. Tumor cell expression of CSF1R is under the control of several steroid hormones (glucocorticoids and progestins) and the binding of several bHLH transcription factors, while tumor cell expression of CSF-1 appears to be regulated by other hormones, some of which are involved in normal lactogenic differentiation. However, studies have demonstrated that CSF1 and CSF1R have additional roles in mammary gland development during pregnancy and lactation. The role of CSF1 and CSF1R in normal and neoplastic mammary development that may elucidate potential relationships of growth factor-induced biological changes in the breast during pregnancy and tumor progression.

  • Sherr CJ. (1990) The colony-stimulating factor 1 receptor: pleiotropy of signal-response coupling. Lymphokine Res. 9(4): 543-8.
  • Kacinski BM. (1997) CSF-1 and its receptor in breast carcinomas and neoplasms of the female reproductive tract. Mol Reprod Dev. 46(1): 71-4.
  • Sapi E, et al. (1999) The role of CSF-1 in normal and neoplastic breast physiology. Proc Soc Exp Biol Med. 220(1): 1-8.
  • Sapi E. (2004) The role of CSF-1 in normal physiology of mammary gland and breast cancer: an update. Exp Biol Med (Maywood). 229(1): 1-11.
  • Bonifer C, et al. (2008) The transcriptional regulation of the Colony-Stimulating Factor 1 Receptor (csf1r) gene during hematopoiesis. Front Biosci. 13: 549-60.