Quick Order

Human GOLM1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GOLM1cDNA Clone Product Information
Gene_bank_ref_id:NM_016548.3
cDNA Size:1206
cDNA Description:ORF Clone of Homo sapiens golgi membrane protein 1 DNA.
Gene Synonym:GP73, GOLPH2, C9orf155, FLJ22634, FLJ23608, PSEC0257, bA379P1.3, GOLM1
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Golgi membrane protein 1, also known as Golgi membrane protein GP73, Golgi phosphoprotein 2 and GOLM1, is a protein which belongs to the GOLM1 / CASC4 family. GOLM1 is widely expressed. It is highly expressed in colon, prostate, trachea and stomach. It is expressed at lower level in testis, muscle, lymphoid tissues, white blood cells and spleen. It is predominantly expressed by cells of the epithelial lineage. GOLM1 is expressed at low level in normal liver. Expression significantly increases in virus (HBV, HCV) infected liver. Expression of GOLM1 does not increase in liver disease due to non-viral causes (alcohol-induced liver disease, autoimmune hepatitis). Increased expression in hepatocytes appears to be a general feature of advanced liver disease. In liver tissue from patients with adult giant-cell hepatitis (GCH), GOLM1 is strongly expressed in hepatocyte-derived syncitial giant cells. GOLM1 is constitutively expressed by biliary epithelial cells but not by hepatocytes.

Size / Price
Catalog:HG13066-CY
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"