Quick Order

Text Size:AAA

Human EIF5 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human EIF5 cDNA Clone Product Information
NCBI RefSeq:BC007728
RefSeq ORF Size:1296bp
cDNA Description:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 5 with N terminal His tag.
Gene Synonym:EIF-5, EIF-5A
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

EIF-5A, also known as EIF5, functions in start site selection as a GTPase accelerating protein (GAP) for the eukaryotic translation initiation factor (eIF) 2•GTP•tRNA ternary complex within the ribosome-bound pre-initiation complex. In protein synthesis initiation, eIF2 functions in its GTP-bound state to deliver initiator methionyl-tRNA to the small ribosomal subunit and is necessary for protein synthesis in all cells. EIF-5A stabilizes the binding of GDP to eIF2 and is therefore a bi-functional protein that acts as a GDP dissociation inhibitor (GDI). EIF-5A also interacts with eIF1 and eIF3 and binds the eIF2-GTP/Met-tRNA ternary complex along with the 40S ribosome subunit.

References
  • Si K, et al. (1996) Charactatierizon of multiple mRNAs that encode mammalian translation initiation factor 5 (eIF-5). J Biol Chem. 71(28):16934.
  • Das S, et al. (1998) Specific interaction of eukaryotic translation initiation factor 5 (eIF5) with the beta-subunit of eIF2. J Biol Chem. 272(50):31712-8.
  • Conte MR, et al. (2006) Structure of the eukaryotic initiation factor (eIF) 5 reveals a fold common to several translation factors. Biochemistry. 45(14):4550-8.
  • Size / Price
    Catalog: HG13932-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"