After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GBP2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GBP2cDNA Clone Product Information
cDNA Size:1776
cDNA Description:ORF Clone of Homo sapiens guanylate binding protein 2, interferon-inducible DNA.
Gene Synonym:DKFZp451C2311, GBP2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

GBP-2 belongs to the guanylate-binding protein (GBP) family. GBPs are characterized by their ability to specifically bind guanine nucleotides (GMP, GDP, and GTP). As GTPases induced by IFN-gamma (Interferon-inducible GTPase), they are key to the protective immunity against microbial and viral pathogens. GBP-2 is a GTPase that converts GTP to GDP and GMP. It binds GTP, GDP and GMP. GBP-2 hydrolyzes GTP very efficiently. GDP rather than GMP is the major reaction product. GBP-2 is induced by interferons that have antiviral effects and inhibit tumor cell proliferation.

  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Wistow G, et al. (2002) Expressed sequence tag analysis of human RPE/choroid for the NEIBank Project: over 6000 non-redundant transcripts, novel genes and splice variants. Mol Vis. 8:205-20.
  • Neun R, et al. (1996) GTPase properties of the interferon-induced human guanylate-binding protein 2. FEBS Lett. 390(1):69-72.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks