Quick Order

Human PDE2A ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PDE2A cDNA Clone Product Information
Gene_bank_ref_id:NM_002599.3
RefSeq ORF Size:2826bp
cDNA Description:Full length Clone DNA of Homo sapiens phosphodiesterase 2A, cGMP-stimulated with C terminal HA tag.
Gene Synonym:PDE2A1, PED2A4, PDE2A
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

cGMP-dependent 3',5'-cyclic phosphodiesterase, also known as cyclic GMP-stimulated phosphodiesterase and PDE2A, is a peripheral membrane protein which belongs to the cyclic nucleotide phosphodiesterase family and PDE2 subfamily. Phosphodiesterases (PDEs) comprise a family of enzymes that regulate the levels of cyclic nucleotides, key second messengers that mediate a diverse array of functions. Phosphodiesterases (PDEs) modulate signaling by cyclic nucleotides in diverse processes such as cardiac contractility, platelet aggregation, lipolysis, glycogenolysis, and smooth muscle contraction. PDE2A is an evolutionarily conserved cGMP-stimulated cAMP and cGMP PDE. PDE2A contains two GAF domains. PDE2A is expressed in brain and to a lesser extent in heart, placenta, lung, skeletal muscle, kidney and pancreas. PDE2A is a cyclic nucleotide phosphodiesterase with a dual-specificity for the second messengers cAMP and cGMP, which are key regulators of many important physiological processes. PDE2A is involved in the regulation of blood pressure and fluid homeostasis by the atrial natriuretic peptide (ANP), making PDE2-type enzymes important targets for drug discovery.

References
  • Iffland,A. et al., 2005, Biochemistry. 44 (23):8312-25
  • de Oliveira,S.K. et al., 2007,J Biol Chem. 282 (18):13656-63.
  • Stephenson,D.T. et al., 2009, J Histochem Cytochem. 57 (10):933-49.
  • Russwurm,C. et al., 2009, J Biol Chem. 284 (38):25782-90.
  • Size / Price
    Catalog: HG13031-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"