After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SAE1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SAE1 cDNA Clone Product Information
NCBI RefSeq:BC000344
RefSeq ORF Size:1041bp
cDNA Description:Full length Clone DNA of Homo sapiens SUMO1 activating enzyme subunit 1 with N terminal His tag.
Gene Synonym:AOS1, SUA1, UBLE1A, HSPC140
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

SAE1 belongs to the ubiquitin-activating E1 family. It is a heterodimer that acts as a E1 ligase for SUMO1, SUMO2, SUMO3, and probably SUMO4. It functions as a UBLI E1 ligase mediating the ATP-dependent activation of UBL1. SAE1 binds with UBLE1A and UBLE1B to form a heterodimer which can bind UBL1. SAE1 also regulates ATP-dependent activation of SUMO proteins and formation of a thioester with a conserved cysteine residue on SAE2. SAE1 and UBA2 form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins.

References
  • Gong L, et al. (1999) Molecular cloning and characterization of human AOS1 and UBA2, components of the sentrin-activating enzyme complex. FEBS Lett. 448(1):185-9.
  • Lois LM, et al. (2005) Structures of the SUMO E1 provide mechanistic insights into SUMO activation and E2 recruitment to E1. EMBO J. 24(3):439-51.
  • Tatham MH, et al. (2001) Polymeric chains of SUMO-2 and SUMO-3 are conjugated to protein substrates by SAE1/SAE2 and Ubc9. J Biol Chem. 276(38):35368-74.
  • Size / Price
    Catalog: HG13921-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"