After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human BLOC1S2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BLOC1S2 cDNA Clone Product Information
Gene_bank_ref_id:BC020494
RefSeq ORF Size:300bp
cDNA Description:Full length Clone DNA of Homo sapiens biogenesis of lysosomal organelles complex-1, subunit 2 with N terminal His tag.
Gene Synonym:BLOS2, RP11-316M21.4
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

BLOC1S2, also known as BLOS2, belongs to the BLOC1S2 family. It is a component of BLOC-1 complex. The BLOC-1 complex is composed of BLOC1S1, BLOC1S2, BLOC1S3, DTNBP1, MUTED, PLDN, CNO/cappuccino and SNAPIN. The BLOC-1 complex is required for normal biogenesis of lysosome-related organelles, such as platelet dense granules and melanosomes. BLOC1S2 interacts directly with BLOC1S1, BLOC1S3, MUTED, CNO/cappuccino and SNAPIN. It may play a role in cell proliferation. It also plays a role in intracellular vesicle trafficking. Functionally, BLOC1S2 gene has been proposed to participate in processes (melanosome organization, microtubule nucleation, platelet dense granule organization, positive regulation of cell proliferation, positive regulation of transcription, regulation of apoptosis, positive regulation of transcription from RNA polymerase II promoter).

References
  • Sowa ME, et al. (2009) Defining the human deubiquitinating enzyme interaction landscape. Cell. 138(2):389-403.
  • Gdynia G, et al. (2008) BLOC1S2 interacts with the HIPPI protein and sensitizes NCH89 glioblastoma cells to apoptosis. Apoptosis. 13(3):437-47.
  • Starcevic M, et al. (2004) Identification of snapin and three novel proteins (BLOS1, BLOS2, and BLOS3/reduced pigmentation) as subunits of biogenesis of lysosome-related organelles complex-1 (BLOC-1). J Biol Chem. 279(27):28393-401.
  • Size / Price
    Catalog: HG13916-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"