Quick Order

Human BPIFA2 / C20orf70 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BPIFA2cDNA Clone Product Information
cDNA Size:750
cDNA Description:ORF Clone of Homo sapiens BPI fold containing family A, member 2 DNA.
Gene Synonym:PSP, SPLUNC2, C20orf70, bA49G10.1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

C20orf70 belongs to the BPI/LBP/Plunc superfamily, Plunc family. PLUNC family is comprised by mucosal secretory proteins that are predicted to be structurally similar to lipid-binding and host-defense proteins including bactericidal/permeability-increasing protein and lipopolysaccharide-binding protein. C20orf70 can be detected in submandibular gland. C20orf70 gene contains 9 distinct gt-ag introns. Transcription produces 6 different mRNAs, 4 alternatively spliced variants and 2 unspliced forms. There are 2 probable alternative promotors, 3 non overlapping alternative last exons and 4 validated alternative polyadenylation sites. The mRNAs appear to differ by truncation of the 3' end. 80 bp of this gene are antisense to spliced gene glopa, raising the possibility of regulated alternate expression. C20orf70 is expected to have molecular function (lipid binding) and to localize in extracellular region. It is a salivary protein of unknown function.

  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Vargas PA, et al. (2008) Expression of PLUNC family members in benign and malignant salivary gland tumours. Oral Dis. 14(7):613-9.
  • Bingle L, et al. (2009) Characterisation and expression of SPLUNC2, the human orthologue of rodent parotid secretory protein. Histochem Cell Biol. 132(3):339-49.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items