After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human HMGN3 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HMGN3 cDNA Clone Product Information
Gene_bank_ref_id:BC009529
RefSeq ORF Size:234bp
cDNA Description:Full length Clone DNA of Homo sapiens high mobility group nucleosomal binding domain 3 with N terminal His tag.
Gene Synonym:TRIP7, PNAS-24, PNAS-25
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

HMGN3 belongs to the HMGN family and is expressed in kidney, lung, pancreas, testis, skeletal muscle, heart, thyroid gland, pituitary gland, prostate and uterus. Members of the HMGN family bind to nucleosomes without any specificity for the underlying DNA sequence. They affect the global and local structure of chromatin, as well as the levels of histone modifications and thus play a role in epigenetic regulation of gene expression. HMGN3 regulates the expression of the glucose transporter SLC2A2 by binding specifically to its promoter region and recruiting PDX1 and additional transcription factors. It also regulates the expression of SLC6A9, a glycine transporter which regulates the glycine concentration in synaptic junctions in the central nervous system, by binding to its transcription start site. Both insulin and glucagon levels can be affected by HMGN3. HMGN3 may play a role in ocular development and astrocyte function. It also modulates the expression of pancreatic genes involved in insulin secretion.

References
  • Ueda T, et al. (2009) The nucleosome binding protein HMGN3 modulates the transcription profile of pancreatic beta cells and affects insulin secretion. Mol Cell Biol. 29(19):5264-76.
  • Lei SF, et al. (2012) Genome-wide association study identifies HMGN3 locus for spine bone size variation in Chinese. Hum Genet. 131(3):463-9.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Size / Price
    Catalog: HG13914-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"