After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human KLK-3 transcript variant 1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KLK3 cDNA Clone Product Information
NCBI RefSeq:NM_001648.2
RefSeq ORF Size:786bp
cDNA Description:Full length Clone DNA of Homo sapiens kallikrein-related peptidase 3 , transcript variant 1 with N terminal HA tag.
Gene Synonym:APS, PSA, hK3, KLK2A1
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
References
  • Koistinen H, et al. (2008) Development of peptides specifically modulating the activity of KLK2 and KLK3. Biol Chem. 389(6): 633-42.
  • Yousef GM, et al. (2002) Kallikreins, steroid hormones and ovarian cancer: is there a link? Minerva Endocrinol. 27(3): 157-66.
  • Parikh H, et al. (2011) Fine mapping the KLK3 locus on chromosome 19q13.33 associated with prostate cancer susceptibility and PSA levels. Hum Genet. 129(6): 675-85.
  • Size / Price
    Catalog: HG10771-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"