Quick Order

Human DYDC2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DYDC2 cDNA Clone Product Information
Gene_bank_ref_id:BC007374
RefSeq ORF Size:534bp
cDNA Description:Full length Clone DNA of Homo sapiens DPY30 domain containing 2 with N terminal His tag.
Gene Synonym:DYDC2
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

DPY30 domain containing 2 belongs to the dpy-30 family. Dumpy-30 family members act as determinants of male fertility and interaction partners of metal-responsive transcription factor 1 (MTF-1) in Drosophila. MTF-1 plays a key role in transition metal detoxification and homeostasis. It binds to metal response elements (MREs). Two candidate dMTF-1 interactors are related to the small regulatory protein Dumpy-30 (Dpy-30) of the worm C. elegans. Dpy-30 is the founding member of a protein family involved in chromatin modifications, notably histone methylation. Mutants affect mating type in yeast and male mating in C. elegans. As part of the MLL1/MLL complex, DPY30 domain containing 2 is involved in methylation and dimethylation at 'Lys-4' of histone H3. H3 'Lys-4' methylation represents a specific tag for epigenetic transcriptional activation. DPY30 domain containing 2 may also play an indirect or direct role in endosomal transport.

References
  • 1. Deloukas P, et al. (2004) The DNA sequence and comparative analysis of human chromosome 10. Nature. 429(6990):375-81.
  • 2. Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • 3. Xin X, et al. (2009) Shifted Transversal Design smart-pooling for high coverage interactome mapping. Genome Res. 19(7):1262-9.
  • Size / Price
    Catalog: HG13911-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"