Quick Order

Text Size:AAA

Mouse Hgfac Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HGFAcDNA Clone Product Information
cDNA Size:1962
cDNA Description:ORF Clone of Mus musculus hepatocyte growth factor activator DNA.
Gene Synonym:HGFA, Hgfac
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

HGF activator (HGFA) is a serum-derived serine protease and belongs to the peptidase family S1.HGFA is responsible for the conversion of hepatocyte growth factor (HGF), from the inactive single-chain precursor to the active heterodimeric form, which is a potent mitogen, motogen, and morphogen for liver cells, epithelial cells, and endothelial cells. HGFA is synthesized and secreted by the liver and circulates in the plasma as an inactive single-chain zymogen in normal states. The zymogen is cleaved by thrombin or thermolysin through the endoproteolytic process and forms an active heterodimer linked by a disulfide bond. In turn, the active protease can be inhibited by HGFA inhibitors (HAIs) including HAI-1 and HAI-2. In addition, the HGFA zymogen acquires a strong affinity upon activation and thus may ensure the local action in tissue regeneration in liver, kidney and skin. It has been reported that activation of HGF is a critical limiting step in the HGF/SF-induced signaling pathway mediated by Met, and accordingly, aberrant expression of HGFA is implicated in tumorigenesis and progression.


1.  Shimomura, T. et al., 1993, J. Biol. Chem. 268: 22927-22932.

2.  Miyazawa, K. et al., 1996, J. Biol. Chem. 271 : 3615-3618.

3.  Shia, S. et al., 2005, J. Mol. Biol. 346: 1335-1349.

4.  Kataoka, H. et al., 2000, J. Biol. Chem. 275: 40453-40462.

5.  Tjin, E.P. et al., 2006, Blood. 107: 760-768.

6.  Kitajima, Y. et al., 2000, Cancer. Res. 60: 6148-6159.

Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items