Quick Order

Human AKT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AKT1cDNA Clone Product Information
cDNA Size:1485
cDNA Description:ORF Clone of Homo sapiens v-akt murine thymoma viral oncogene homolog 1 DNA.
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

v-akt murine thymoma viral oncogene homolog 1 (AKT1), or protein kinase B-alpha (PKB-ALPHA) is a serine-threonine protein kinase, belonging to the Protein Kinase Superfamily. AKT1 is a major mediator of the responses to insulin, insulin-like growth factor 1 (IGF1), and glucose. AKT1 also plays a key role in the regulation of both muscle cell hypertrophy and atrophy. AKT1 activity is required for physiologic cardiac growth in response to IGF1 stimulation or exercise training. In contrast, AKT1 activity was found to antagonize pathologic cardiac growth that occurs in response to endothelin 1 stimulation or pressure overload. AKT1 selectively promotes physiological cardiac growth while AKT2 selectively promotes insulin-stimulated cardiac glucose metabolism. AKT1 deletion prevented tumor initiation as well as tumor progression, coincident with decreased Akt signaling in tumor tissues. AKT1 is the primary Akt isoform activated by mutant K-ras in lung tumors, and that AKT3 may oppose AKT1 in lung tumorigenesis and lung tumor progression. A number of separate studies have implicated AKT1 as an inhibitor of breast epithelial cell motility and invasion. AKT1 may have a dual role in tumorigenesis, acting not only pro-oncogenically by suppressing apoptosis but also anti-oncogenically by suppressing invasion and metastasis.

  • Hollander MC, et al. (2011) Akt1 deletion prevents lung tumorigenesis by mutant K-ras. Oncogene. 30(15): 1812-21.
  • Devaney JM, et al. (2011) AKT1 polymorphisms are associated with risk for metabolic syndrome. Hum Genet. 129(2): 129-39.
  • Dillon RL, et al. (2010) Distinct biological roles for the akt family in mammary tumor progression. Cancer Res. 70(11): 4260-4.
  • Toker A, et al. (2006) Akt signaling and cancer: surviving but not moving on. Cancer Res. 66(8): 3963-6.
  • Muslin AJ, et al. (2006) Role of Akt in cardiac growth and metabolism. Novartis Found Symp. 274: 118-26.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 Business days
    • Human AKT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged
    Recently Viewed Items