Quick Order

Mouse EPOR ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse EPOR cDNA Clone Product Information
Gene_bank_ref_id:NM_010149.3
RefSeq ORF Size:1524bp
cDNA Description:Full length Clone DNA of Mus musculus erythropoietin receptor with C terminal Flag tag.
Gene Synonym:EPOR
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-mEPOR-flag
Restriction Site:KpnI + XbaI (6kb + 1.56kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Erythropoietin (EPO) is the major glycoprotein hormone regulator of mammalian erythropoiesis, and is produced by kidney and liver in an oxygen-dependent manner. The biological effects of EPO are mediated by the specific erythropoietin receptor (EPOR/EPO Receptor) on bone marrow erythroblasts, which transmits signals important for both proliferation and differentiation along the erythroid lineage. EPOR protein is a type â…  single-transmembrane cytokine receptor, and belongs to the homodimerizing subclass which functions as ligand-induced or ligand-stabilized homodimers. EPOR signaling prevents neuronal death and ischemic injury. Recent studies have shown that EPO and EPOR protein may be involved in carcinogenesis, angiogenesis, and invasion.

References
  • Divoky V, et al. (2002) Mouse surviving solely on human erythropoietin receptor (EpoR): model of human EpoR-linked disease. Blood 99(10): 3873-4.
  • Carruthers SG. (2009) A truncated erythropoietin receptor EPOR-T is associated with hypertension susceptibility. Clin Pharmacol Ther. 86(2): 134-6.
  • Baltaziak M, et al. (2009) Relationships of P53 and Bak with EPO and EPOR in human colorectal cancer. Anticancer Res. 29(10):4151-6.
  • Size / Price
    Catalog: MG50031-CF
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"